Sunday, February 03, 2008

A in Amore is for Alleles

Every time a female chooses a male based on a trait, she perpetuates that allele that caused her to makes that choice and allows a male with a particular phenotype to perpetuate his allele.

With this in mind, the following are some phenotypes that female humans may consider when choosing a mate:

1) Personality-funny, witty, courageous, determined, sensitive, understanding, poetic, and intuitive

2) Appearance-tall, clear skin, proportionate body portions, hair on head, large eyes, endowed in private areas, straight teeth

3) Intelligence-conversations with deep subject matter, problem-solving abilities, and analytical skills

Disclaimer: Although these are some "ideal" traits, other less desirable traits are passed on. Females who are unable to acquire these traits for her offspring (for various reasons such as no mating skills, naivety, appearance, and/or career woman) will mate with men who express detrimental alleles, which continue to pollute our gene pool.

Friday, February 01, 2008

A Year Later

I miss him.

Tuesday, February 20, 2007

some days are worse than others

picked up the phone far too many times...

Tuesday, February 06, 2007

WTF???

Jaundice, a yellowing of the skin, is found in 60% of newborn babies. It is caused by elevated levels of bilirubin, which is a byproduct of dead red blood cells. It only costs $1 to test newborns for bilirubin levels. A good reason to test the 60% of newborns with yellow skin is that it could possibly lead to kernicterus, brain damage that will affect the baby for the rest of his/her life.

What upsets me is that the American Association of Pediatrics fails to take jaundice seriously, stating that they do not want to exhibit an "alarmist" approach to such a rare possibility of brain damage. Although about 40 of the 4 million babies born annually in the U.S. are affected with kernicterus, these 40 babies could have had a chance to live a normal lifestyle. Instead, they are inflicted with cerebral palsy (permanent brain damage) and lack the ability to live independently.

Cal, a 12-year old boy with kernicterus once told his mom, "When I grow up, I want to be the best daddy in the world-but if I have a baby, I'm afraid I'll drop it."

A prospective indicator of brain damage is a compelling reason to be a bit alarmist, no matter how "rare" this occurence is.

Saturday, February 03, 2007

Monday, January 29, 2007

Life's Simple Pleasure #5

WARM LAUNDRY AND THE SMELL OF LAUNDRY DETERGENT

Stupid Girl

She was smiling, thinking everyone liked her.

If only she knew the twisted things that run through their heads.

Sunday, January 28, 2007

Why, why WHY??

Why do humans have the need to feel important?

Life's Simple Pleasure #4

Normalizing an awkward situation.

Happy...Again


Wednesday, January 24, 2007

wanna put my tender heart in a blender


Eve 6

Life's Simple Pleasure #3

Basking in loneliness.

For some reason, this makes me really sad

Setting: University Center, 10PM

Characters: Two 'nerdy' boys.

Boy 1: "You weigh maybe 140?"

Boy 2: "No, I don't, but thank you for saying that, it really boasts my confidence level."

Tuesday, January 23, 2007

Raje3 Yit3amar Libnan

That song used to be such an inspiration about hopes to start my life in Lebanon...

When their is such deep division in such a diverse country, I ask myself:

"How the hell can this issue be resolved?"

Do the southern Lebanese really believe that their actions will lead to fruitful results?

Will smashing vehicles, polluting the environment, and shuting down the country help them achieve their goals?

Why doesn't Nasrallah go out in the street and help them destroy Lebanon?

They proclaim themselves to be Muslims, but their behaviour is far from Quranic doctrine.

Lets brace ourselves and see what's yet to come.

Thursday, January 18, 2007

if i died

would anyone notice that i was gone?

Tuesday, January 16, 2007

Encounter

It was a frigid day and my shoulders were burning from the heavy books I carried from the parking lot across the bridge. I noticed him near the corner of the large fountain. He held his silver metal stick, trying to get a feel to where he was. He was lost.

"Excuse me," I said. He turned immediately at me with those shiny blue sports sunglasses.

"Can I help you find a place?"

As we walked, I learned that he was looking for the other fountain on campus. The sound of the metal stick tapping against the concrete sounded vaguely familiar. As we headed to the fountain that lead to the bridge that led to his dorm, he almost ran into a tree, shrubs, and stairs.

He was strikingly handsome.

"What's your name?," I asked.

"Jesus," he extended his hand. I shook it and replied, "I'm Zeina."

Our walk ended and I wished I could've walked more with him.

There are some people you meet who do not say one word to you but influence you in ways unimaginable.

I wonder if he got home safely.

Sunday, January 14, 2007

Aint Boy Crazy No Mo

As of January 1st, I shall abstain from men in any form or fashion.

Exception to this declaration is extended to but not limited by long-time, established male friends and/or classmates.

I am doing this to cleanse myself of my recent (adolescent-present year) preoccupation with the beloved opposite gender.

I feel in control, impowered, and liberated.

My goal will be one year, let's see how it will go!

Saturday, January 13, 2007

Friday, January 12, 2007

Life's Simple Pleasure #2

Crawing into a warm bed.

Dear X,

After our talk, I realized that your view of women is as antiquated as cavemen running around firecamps. Your comments such as, "Our women don't...(fill in blank here)" proves that you are a mysogistic bastard who deserves to dwell in a bottom-less pit of hell.

As much as I would like to say that I hate you, I won't. You are influenced by your environment, wealthy men who run around the city with their tongues dragging behind them, their minds fixed in a trance of lust.It may also be your father, who always treated your mother as sub-human, yelling at her, sometimes even striking her, for simple things like not heating the food right. You don't know this, but she (a woman) is the one who keeps your family together.

Maybe one day you will rub off the goo in your eyes and see that a woman's autonomy is necessary for a properly functioning child, that child is you.

Sunday, January 07, 2007

Thank You

For showing me early on that you are not the man for me.

To Africa? or Not to Africa? that is the question

My feelings and compassion towards women with fistula continues to burn and the voice resonates inside me..."Go, Zeina, go to Niger"

My itnerary is here, the ticket is payed for, my vaccines are prepared....

and I will decline the trip tomorrow.

I have come to realize that dreams come with dangerous realities...

The risks outweigh the benefits ...I hope I am making the right decision.

Disappointment is up to my nose.

Friday, January 05, 2007

beware the leader who bangs the drums of war in order to whip the citizenry into a patriotic fervour, for patriotism is indeed a double-edged sword. It both emboldens the blood, just as it narrows the mind.

and when the drums of war reached a fever pitch and the blood boils with hate and the mind has closed, the leader will have no need in seizing the rights of citizenry. Rather, the citizenry, infused with fear and blinded with patriotism, will offer up all the rights unto the leader, and gladly so.

Friday, December 22, 2006

Thursday, September 21, 2006

Another Blogging Break



Be back in a couple of months!

Monday, September 18, 2006

Almost Done

Sunday, September 17, 2006

Lebanese Government?



Everyone wants to be the leader, but not enough followers.

Saturday, September 16, 2006

Thursday, September 14, 2006

The Pain Reflected in this Song

I didn’t mean it when I said
I didn’t love you so
I should have held on tight
I never should have let you go
I didn’t know nothing,
I was stupid, I was foolish
I was lying to myself.....
I couldn’t have fathomed
I would ever be without your love
Never imagined I’d be sitting
Here beside myself
Guess I didn’t know you
Guess I didn’t know me
But I thought I knew everything
I NEVER FELLLLLLLLLT

The feeling that I’m feeling
Now that I don’t hear your voice
Or have your touch and kiss your lips
Cause I don’t have a choice
Oh what I wouldn’t give
To have you lying by my side
Right here cause baby

When you left I lost a part of me
It’s still so hard to believe
Come back baby please 'cause
We belong together
Who else am I gonna lean on when times get rough
Who’s gonna talk to me on the phone
Till the sun comes up
Who’s gonna take your place
There ain’t nobody better
Ohhhhhhh baby baby
We belong together

I can’t sleep at night
When you are on my mind
Bobby Womack’s on the radio
Singing to me “If You Think You’re Lonely Now”
Wait a minute this is too deep, too deep
I gotta change the station
So I turn the dial tryin’ to catch a break
And then I hear Babyface
“I Only Think Of You” and it’s breakin’ my heart
I’m tryin’ to keep it together but I’m falling apart

I’m feeling all out of my element
Throwing things, crying tryin’
To figure out where the hell I went wrong
The pain reflected in this song
Ain’t even half of what I’m feeling inside
I need you, need you back in my life baby

When you left I lost a part of me
It’s still so hard to believe
Come back baby please cause
We belong together
Who else am I gonna lean on when times get rough
Who’s gonna talk to me on the phone
Till the sun comes up
Who’s gonna take your place
There ain’t nobody better
Oh baby, baby
We belong together

When you left I lost a part of me
It’s still so hard to believe
Come back baby please 'cause
We belong together
Who am I gonna lean on when times get rough
Who’s gonna talk to me till the sun comes up
Who’s gonna take your place
There ain’t nobody better
Oh baby, baby
We belong together

M. Carey

Tuesday, September 12, 2006

5th Floor




The 5th floor of our central library is reserved for quiet study.

Oftentimes, I hush those who think they are above the "complete silence" rule, other times I have asked a woman to leave and when she didn't, I had a librarian ask her to leave. In other words, don't mess with me, I am the LIBRARY QUEEN :)

Lately, I have been contemplating something: When i graduate this semester, I will dance in an indiscrimnate manner ontop of the 5th floor desks where I have spent years of studying..there will be music.....pictures will be taken.

Saturday, September 09, 2006

Fistula

Dr. R has the most genuine intentions. It was not until we began our dinner at the conference that she presents her video about women with fistula. As I ate Talapia with mango sauce, each bite became harder to swallow. I will do something about this...

Fistula is an injury that occurs during child labor when lack of blood supply to the bladder and vagina causes tissue to die. Basically, two of the three genital orifices become one. Without any tissue, women cannot control fecal and urine excretion. They are ostracised from their families and communities because they give off a rancid smell.

About 100,000 new cases of fistula occur each year. I am really bothered by this number..it is so easy to toss around numbers..100,000 people...something must be done.

More information about Fistula

Thursday, September 07, 2006

Rafa3to Rasnah

I was leaving the shopping center, when I heard her speaking Arabic, I smiled, said hello. Typical Arab exchanges where made, "Where are you from?"

I reply, "Lebanon"

She replies, "Rafa3to Rasnah" (You made us proud).

I smiled my tight smile when I disagree with a person and politely said, "Thank you"

There was so much I wanted to tell this woman. To explain to her that the Lebanese people are suffering and will continue to suffer. That a decade from now, thousands will suffer from environmentally induced cancer. That from the blood that watered the ground will blossom new fanaticism and hatred. The Lebanese government is filled with corrupt baboons, and this is an understatement.

Although pessimism will not alleviate the situation, one must agree that Arabs are extremely divided. 'Establish a business that caters to Americans, just stay away from the Arabs' is a common phrase heard amongst Arab entrepreneurs.

Personally, I find my non-Arab friends more trusting and caring than my Arab ones. This, however, is just my experience and may not reflect the behaviour of the entire Arab community.

Sunday, September 03, 2006

Through It All



What hurts the most, was being so close
Having so much to say, watching you walk away

Sunday, August 27, 2006

Human Behavior and Complexity

Whoever said man is a simple being is out of touch with reality.

We are far from simple.

Hidden agendas, thoughts, and wonderings lurk behind those eyes and it is interesting (and funny) to watch when a person is not telling the truth.

Is it ok to lie? It depends on the circumstance and if anyone gets hurt in the process. Personally, I do not care unless it harms someone.

Honey, I know he is not the father of your child, the paternity test says so!

Friday, August 25, 2006

Life's Simple Pleasure #1

Coffee with friends, subject matter: men

Monday, August 21, 2006

Quand je n'arrive pas à m'exprimer

Je pense bien que le monde est calculé
Je pense bien que tout est encadré
Que nos pensées sont tracées dans l'air auparavant
Et tu crois que la derniere prise
Elle a mis du temps ta douleur

Ouvre les yeux le monde change

Ah oui je sais qu'un jour
Ah oui je sais qu'un jour

Pour voir plus clair
Tu dois oublier tous les mensonges
Ah le monde change, le monde change

Soulage ton coeur, soulage ton ame
Ah le monde change

Et tu crois que la derniere prise
Elle a mis du temps ta douleur
Ta douleur, ta douleur

Demain est une autre sortie
Ca fait mal dire mais j'ai peur, j'ai peur, j'ai peur

Ah le monde change, le monde change
Soulage ton coeur, soulage ton âme
Ah le monde change, le monde change

(Thievery Corp. Le Monde)

Monday, August 14, 2006

Long Live Lebanon!

After a month of unrelenting abuse from their neighbors, the Lebanese people prevailed! Today, the IDF holds its head down in shame while the Lebanese lick their wounds and seek for a better tomorrow. Today, my alarm clock wakes me to better news: Lebanese stock improved tremendously, the Lebanese were able to withstand one of the most advanced armies in the world.

Israel sought to divide and conquer, but what they did was embed a sense of nationalism that has been hammered into every Lebanese around the globe.

Friday, August 11, 2006

Learning to Read the Paper

At the age of 22, I have finally learned how to read the paper. Let us take a look at, my favorite, the New York Times. (The parentheses are the stuff that should be understood from the article.)

Israel Asks U.S. to Ship Rockets With Wide Blast

By David S. Cloud

WASHINGTON, Aug. 10 — Israel has asked the Bush(mert) administration to speed delivery of short-range antipersonnel rockets armed with cluster munitions, which it could use to strike Hezbollah missile sites (or baby Ali, mommy, whoever the hell gets in the way) in Lebanon, two American officials said Thursday..

But some State Department officials have sought to delay the approval because of concerns over the likelihood of civilian casualties (Bush's approval rating has plummeted, perhaps?), and the diplomatic repercussions (everyone already hates us). The rockets, while they would be very effective against hidden missile launchers, officials say, are fired by the dozen and could be expected to cause civilian casualties if used against targets in populated areas (whoa, shocker!)...

If the shipment is approved, Israel may be told that it must be especially careful (as in 33% of your targets are kids) about firing the rockets into populated areas, the senior official said.

Sunday, August 06, 2006

For You, Georgie

Gandhi is right:

"What difference does it make to the dead, the orphans and the homeless, whether the mad destruction is wrought under the name of totalitarianism or the holy name of liberty or democracy?"

The Way My Coffee Cup Sees It

All unhappiness and stagnation
Result from a feeling that you are
At the mercy of the world and the people in it.
But what a joy it is, what a major shift to strength and
Power, when you no longer wait around for others to favor and
Love you, for others to flatter and reward you. Reward and flatter
Yourself, favor and love yourself.

-Kira Salak

Friday, July 28, 2006

Video et Taceo

Serenades of spite
Sung across shores

Sweet sleep seeks
Sadistic souls

Saturday, July 15, 2006

The Rape of Lebanon

A half world away,
The furrow deepening my brow
Like the furrow in the land.

I watch.

Flames consume the land
And burns my heart.

A voice from afar repeats:

We will prevail, we will prevail!

Wednesday, June 07, 2006

You'll Need a Kleenex

I've realized that I am spending too much time in cyberspace than in bookspace...so then I got to do what I got to do.....

I am leaving the blogmunity and will be back in mid August, see y'all then.

Take Care!

Tuesday, June 06, 2006

Lil Birdy

Little birdy in the tree,
How I long to be with thee!

Saturday, June 03, 2006

Mein Kompf

You know what? I was going to write about how my life is seriously sucking right now. I was going to boohoo to you about how I have been betrayed. I even thought of a lovely story about how I stood up for what was right and lost supposed 'friends'.

No, no, I won't do that.

At the end of the day, I have some dignity to look in the mirror and sleep well at night. I am going to bust my ass and try my best to get this test under my belt..then, my career will have some meaning to it....when I reach my goal, I CAN actually do something about what I read in the paper.. I will add my LITTLE BRICK to the big building...

I don't live in Darfur, nor Iraq, nor Kashmir.... All this fussing about my books, my test, my loneliness, mean nothing..as I type on my nice laptop in an air conditioned study room, there are people living through HELL..who have to witness atrocities and don't even have the means to do anything about it....

I am going to suck it up and push myself like I have never done before, then I can at least say that I did my best.

Wednesday, May 31, 2006

Verbatim

"I would say the best moment of all was when I caught a 7.5 lb. perch in my lake."

George W. Bush answering a German newspaper reporter who asked him to name the best moment of his five years as President.

Time Magazine May 2006

Monday, May 29, 2006

Law of Probability and My Messy Room

I don't like to share this with many, but only between you and me.

I like things tidy and neat. As I was folding yet another shirt today, I asked myself, "Why is it, that it is easier to dirty a room than to clean it?"

Because, my dear, we are victims of a law of probability. You see, there are more chances, more places, more spaces for something to be outside of its place, than the small likelihood that it would be in its right place.

The world is increasing in entropy (randomness) and I must learn to live with it!

Friday, May 26, 2006

Heavy Sigh

Okay, so I high-jacked this off 'his' web space. I doubt he would mind, considering:

A) I am the person he his referring to.
B) He took my idea.
C) He doesn't know about this blog ;)
D) It made me feel so good that I had to share.

...And then came the day where my sense of perception shifted to some new level ... even though I was playing the song for the first time, I could swear i was anticipating like every word in it, there were even times when i let myself play on some of the words ... OK, maybe a lot of them. They weren't just expressive enough, you see ... To this point, I must at least got you wondering what was so catchy about this song. Was it the singer, the writer, the producer maybe . I tell you it was a listener, the listener ... a listener who once said that she looks so much like the girl in the song, and I believe without the least doubt that there is no way something so heavenly would be described with earthly words, but to my mind it added another piece to a beautiful puzzle i have been putting together for quite some time. Could you imagine a talking Charlie Chaplin with a dolby surround, a Monaliza giving you the blink, a 3D Tom&Jerry, I say it had the same effect ... I finally got the perfect stimuli to blow some soul into that still masterpiece hanging on the back of my head... Learn the words, boys and girls, I might need you in the chorus for my next big party ;)

Are you a nurse?

I respect nurses, I really do. The world needs nurses as much as we need doctors, technicians, etc.

However, if another person asks me if I am a nurse, I am going to say something really, really, really mean.

Monday, May 22, 2006

Long distance relationships and Newton's Law

So this summer is the 'make it or break it' into med. school. So I whimpered 'no' to an offer to visit Lebanon in hopes of concentrating on the lovely test that I adore oh so much.

I am waisting time, guiltily, but amusingt myself with the correlation that I see with the physical sciences and relationships...for example:

All objects have some sort of attraction to each other...we exert an attractive force on Earth and it does the same to us...only the Earth's mass is much larger than ours, so our force is negligible. The farther two objects get from each other, the less the attractive force...

And that brings me to us, humans, the father we seperate from each other...the harder it is to maintain that attractive force...those who are in long distance relationships are at a disadvantage than their nearby counterparts...thank God for globalization!

Saturday, May 20, 2006

Let's Get Off Our High Horse!

Iran's President Mahmoud Ahmadinejad advance to open communication with the U.S. is an invitation that the U.S. should accept. Opposition of diplomacy with Iran stems from fear that it will hinder international community involvement. Some believe that by speaking to Iran, the U.S. is contradicting its claim that this regime is 'evil'. Because we, the U.S., have branded this country as such, talking to them will show volatility to our enemies and friends, but that is a shifty foundation for a weak argument.

The benefits to diplomacy far outweigh throwing down the gauntlet. First and foremost, we do not have the resources for another burdening war. We have already spent over $100 billion on Iraq. Also, we cannot prove to the international community the justification of military action unless we have used all possible political maneuvering. The belief that by speaking to the enemy, we are endorsing their ideology is nonsensical. The U.S. has communicated with Iran not too long ago during the onset of the war on terror. So why can't we talk once again?

Interesting

Monday, May 15, 2006

Cannot Be Said Better

I love you when you bow in your mosque, kneel in your temple,
pray in your church.
For you and I are sons of one religion,
and it is the spirit.
Gibran Khalil Gibran

Ode to Heart Ache

In my eyes, you will never see
The torment and agony

Laugh and giggle,
Pretending to be
A woman who is not me

If I were to show you inside
It would be an utter surprise

But, you see, I put on a good show
For you never really did know.

Yet I

agony
fear
lust
hate
anxious
overwhelmed

Tuesday, May 09, 2006

The World's Oldest Profession

Prostitutition is a legal profession in Germany. In fact, prostitutes not only get health care benefits, but also pay taxes as well. Unfortunately, competition from eastern European women who offer their services at a cheaper rate are deflating the price of 'love'.

Native prostitutes are now changing careers to be elderly caregivers. Other prostitutes in the country will not give up their avocation, claiming, "No way, I am making too much money here to switch careers."

Consequently, the upcoming World Cup is a lucrative event for these scarlet women, a chance to cash in on their trade.

No comment.

Monday, May 08, 2006

Recant

After my fellow bloggers brought to my attention Albright's statement about the concessions the U.S. is willing to make regarding the killing of half a million civillian lives in Iraq, I have decided to take back my statement.

Madelein Albright, I no longer heart you!

Saturday, May 06, 2006

Discipline

Although most people believe that it is what you do that defines you..lately I am realizing that it is the things I don't do that define me.

Wednesday, May 03, 2006

I Heart Madeleine Albright

I like her.

Not only because I liked the way she handled herself in the interview (i.e. very direct, good eye contact) but also two statements:

1. She not only openly expresses her concern about our country's place in the international arena, but also has the guts to tell our President to his face.

2. She says, "There is a special place in hell for women who do not help each other."

Tuesday, May 02, 2006

Bedeh Beirut







I wish I could click my heels and be in my country.

Delete

Hey Zeina!

This is X. I am calling you because I desperately need you...remember? I only call you whenever you are of use.

Call me back!

Tuesday, April 25, 2006

Saterday is spelt Saturday

Sorry for any inconveniences this may have caused :)

Ain't No Sunshine When She's Gone

When she frowns, a cloud is cast upon our skies.

Saturday, April 22, 2006

Saterday Recollections

There comes a point in a woman's life where the empty overtures of men, the abundant flowers, and sunshine of the world are equated with horseshit.

One is quick to state, "What an insolent and unworthy girl! She has the world at her feet and she still asks for more."

What is at your feet? Ultimate happiness for you may be a thing I dread.

My happiness will no longer be dependent on others.

If I depend on another person's wanton mood then how will I live my life?

My whole life, I sought the approval of family, friends, and the community.

There is a realization that I am living a life like a marionette and my master is the worries of "what will people think?".

Snip the strings that tie you before it is too late!

Monday, April 17, 2006

Are you stalking me?

Texas summer heat is here and the swealtering sun showed no remorse as I ran my errands on campus. The university landscape has improved tremendously since my freshman year. As I was walking to a review session, a violist in the music balcony was serenading me with her homework and I relish the two minutes before I had to imprison myself in another lecture. I passed by a good friend, who happened to run into me twice already...his reaction is: Are u stalking me? Because that would be great. I answer, "Today must be your lucky day!"

I am unsure if this is a Texan reaction (when you see someone repeatedly throughout the day) or if it is common in other cultures....but it is used often on our campus

This brings me to another afternoon coffee break with a good friend of mine, let's call her M. I am going to write more about M in the near future..but for now, M and I have been friends for years and she has showed me a view of this world that I would never have seen. I admire and consequently envy her. This envy is not the type of ill will that most people associate with envy but it is the healthy type that encourages you to work to have qualities like that person.

Today, she told me something that I would never have known about her. She, too, saw qualities in me that she also wish she had.

I never thought that she felt the same way about me. In ways, I wanted to be like her and she wanted to be like me. This type of yearning may be perceived as a type of negative emulation where we all try to have a homogenous character. I disagree. I see it as a natural yearning to exhibit qualties that we sense we lack. We all strive to be wanted and liked, so we want to exhibit qualities like intelligence, humour, and beauty to make us appealing to others.

My dad always tells me to surround myself with people whom I can learn from. These friends have shaped me into the person I am today.

When summer comes, I am going to attribute posts to those who have shaped me and also give an interesting biography of their lives...

Wednesday, April 12, 2006

Only In America

Guess what folks?

Today, I got paid $120 cash for giving my opinion. I swear. I am on a list and meet the criteria. I was fed, watered, paid, and asked to criticize and judge...I'd like to see this happen in Lebanon.

Only in America

Patience My Friend

You will have the world at your feet if you learn to be patient.

'But I am Lebanese, isn't there a hookup?'

Tuesday, April 11, 2006

Huh.

My parents were right all along.

Saturday, April 01, 2006

Rude Awakening

Every word that comes out of your mouth must be censored, for you never know who you will piss off.

-ZA

Saturday, March 25, 2006

Our Need To Touch

I never understood religions that view sex as an act of sin. Physical contact is necessary to maintain sanity and physical health. The Shakers give a good example of the impact that complete chastity has on individuals. Shakers were prohibited to have sexual intercourse amongst each other and so had to express their needs in the form of ecstatic dancing and energetic ceremonies. Their deep devoutness caused them to shake uncontrollably, hence their name.

This is not a testimony that I agree with premarital sex. An act of love must be shared between two people who love each other so much that they formally have announced it to the world. Also, sex after marriage provides protection for both individuals. I have seen my friends who engage in acts before marriage have had a devastating impact when\the other partner decides to leave or cheat. Marriage is a commited step, besides making love is not making love unless it is with a person who you truely love.

Friday, March 24, 2006

Venetian Glass

As one who sails upon a wide, broken sea
Far out of land, his mind intent up on the sailing of his little boat.
On tightening ropes and shaping fair his course,

Hears suddenly, across the endless sea.
The rhythm striking of some towered clock.
And wakes from thoughtless idleness to time;
Time; the slow pulse which beats eternity!

So through the vacancy of busy life.
At intervals you cross my path and bring
The deep solemnity of passing years.
For you I have shed bitter tears, for you
I have relinquished that for which my heart cried
In selfish longing.

And to-night, having just left you, I can say"

"Tis well, Thank God I have known a soul so true,
so nobly just, so worthy to be loved."

-Amy Lowell

Typing this out helps sooth the pain.

Thursday, March 23, 2006

everything will all fall into place, you just don't know it yet

Monday, March 20, 2006

Zeina is HAPPY

so, guess what? i thought i couldn't do it and i did! i did! i did! hallelujah!!!!!!!!

here it is, my defined ends:


TATTAGGTCAGTCAATAAGTTTTGTCGTTTTTTCTCAATTTTGATTTTTT CTTAGATATT
TTTTTGTGGTTATATAGAAGACTGTTAGTAATGACAAGCCCAACAATATCAGCCATATCG
GACTACTCCCAGATATTTTAAATCTCAGAACTGTGATGACGAAAAAAAAATTTTTTTTTC
GATTTTTTTTATTTTTTGGCGAAATGAAAAACTTTATATGCCCTGATGTATTAGACAGTT
AGTTGAATAAAAATCTGCAGTTAAAGCCCCATGCATAGCTTTTTGGTGGCGCTACACTCA
TTAAAATGACCAAAAATGCTTGCAAAAATGATTTTTTAAACTTTGAAGGACGCTAACTTC
CGCAACGTGCAAGATACAAAAAAGTAATCAATTACAACATTAATAAGCACATCAAGAGCT
ACATTTTATCAGTATACTACTTGTTTCTATCTTCACCCGCTGCTAAGTTACAGTCAGTTG
AAACAAGCCAAGTCCAAGTTTCAATAAACACCCTTTTTCCAGATTTTCGCCGGTAACTCC
AAAACCAGTTGTTTTCCGAAATTTTTGTCAACAGATTAAATAATCACTTTTTAATTTTAC
ACATTTTCGTAGTTGAAACTTTTGTCATATCTTAAGTGTTGGAAAAGATATCAGACAATT
AAGCGAACTCGTCCAAATTTGTAAAAAATTTCAAAAATCATCGTGAAAAAATTTCGAAAA
AAAAATTTTCAGAGAAAAAGGCCTAAACATTTTTGAAAATGAATAAGTAACTTTTAACTA
AAACTTTGCATATACTTTCATTGGTCAGCTTTACTTTTGTGGAGAGAAAAACAGAACTTT
GGAGGATTTTTCCATTTTTAAAAAACTACGCAAATTTTTTTCTTTGATGATTAATATTTT
TGCAAAAACCTTAGATATAACAAAAGTTTCAACTACAAAAATGTGTAAAATTAAAAAGTG
ATTATTTCATCTGTTGACAAAAATTTCGGCAAACAACTGGTTTTGGAGTTACAGGCGAAA
ATCTGGAAAAAATGTGTATATTAAAATTTAAAATTTGCTTAATTCAAATAAATTTTACTA
AATATTGAGTAAATATAAAAAAAAAAAGAAAATTTAAAAAATTTATAATTAATGTGCTTA
TTAATGTTGTAATTTATTACTTTTTTGTATCTTGCACATTGCGGAAGTTAGCGTCCTTCA
AAGTTTAAAAAATCATTTTTGCAAGCATTTTTGACAACTTAAACGAATATAGCGCCACCA
AAAAGCCATGCATGAAGCTTTAACTGCAGATTTTTATTCAACTAACTGTCTAATACATCA
GGGCATATAAACTTTTTCATTTCGCCAAAAAATAAAAAAAAACGAAAAAAAAAATTTTTT
TTCGTCATCACAGTTCTGACATTTAAAATATCT4GGAAGTAGTCCGATATGGCTGATATTG
TTGGGCTTGTCATTACTAACAGTCTTCTATATAACCACAAAAAAATATCTAAG AAAAAAT
CAAAACTGAGAAAAAACGACAAAACTTATTGACTGACCTAATA



Sunday, March 19, 2006

Nothing in this world that's worth having comes easy.

Thursday, March 16, 2006

World's Perfection

I was peeling a tangerine today and was wondering how this item came to be. One can think of it as a magic act of God which deserves merit because something so perfect cannot be an accident. The other side is thinking about the DNA mechanism of the plant that made this fruit. The way the fruit is partitioned off into slices, the thin layer of skin protecting the fruit, and the ridges that define its overall structure..

then I thought, I am really eating an ovary of a plant...going even further..smelling a flower is really just smelling a plant's genitals, i just had to say it *blush*

Wednesday, March 15, 2006

Overachievers Inc.

It's spring break in A-town...spent the day at the library..it's funny, the only people there were foreign students...LOOSEN UP PEOPLE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Saturday, March 11, 2006

Random Rambling

I was sitting at a coffee shop and saw these girls all dolled up with their pointy heels, curly hair, and stylish handbags...to me, they looked a bit gaudy....

it is nice to look stylish, and I don't mind looking presentable to people, you know, clean and put together,...but it is when people go above and beyond with material objects such as cars, diamonds, and designer clothing that I start to cringe and think to myself of a quote from the Holy Quran:

The material things which ye are given are the conveniences of life and the glitter thereof, but that which is with God is far better and more enduring. Will ye not then be wise??

Something occured to me today, If I base my identity on mere objects, what will happen if I lose them...it is better to base yourself on intangible things.

I am not a religious person, and am just a mere student who has so much learning to do.

Monday, March 06, 2006

Have you looked up lately?

After the planetarium opening at the university, I have a newfound fascination with the stars and planets that loom above our heads.

It is the most amazing sight...a black sky with specks of diamonds thrown up everywhere...in Texas, I can see Mars so clearly...it is the "star" that looks red next to the moon.

When I feel like being inspired, I walk outside and look up.

It makes you feel insignificant yet significant, if that makes any sense.

Have you looked up lately?

After the planetarium opening at the university, I have a newfound fascination with the stars and planets that loom above our heads.

It is the most amazing sight...a black sky with specks of diamonds thrown up everywhere...in Texas, I can see Mars so clearly...it is the "star" that looks red next to the moon.

When I feel like being inspired, I walk outside and look up.

It makes you feel insignificant yet significant, if that makes any sense.

Sunday, March 05, 2006

Lady Fate

Lady fate does not want me to do my research work today....I am locked out of my lab..and when I try to hop on the system from home, I learn that I don't have Microsoft office on my new laptop...

*sigh*

Friday, March 03, 2006

Je ne peux pas dormir...

So I am sitting here, waiting to sleep...but I can't..so, here I am.

There is this woman I see occasionally...an African woman who wears colorful headscarfs...today I learned that she used to be a fighter pilot for a country....my motif this year seems like a recurring theme of appearances vs. reality..because by looking at this woman, you would think she was a meager housewife, yet her life was and probably still is different than I had imagined it...

I was talked into going into the clinic tomorrow, we have 80 patients to see....that's craziness...but someone's got to do it..I think I'll wear my Nike's

Monday, February 27, 2006

Another Day

And yet I find myself repeating my weeks over and over again..

I can tell you how my day will be tomorrow, how it was yesterday, and how it will be next week...

This monotonous life eating away at my bones..

Is this it? I will get into med school, spend hours and hours studying, then get into a fellowship, work at a hospital, get married, have kids and then die.

Sounds fantastic.

Friday, February 24, 2006

Ethics, Fear, and the Like

Michael Gelb says in his book about the world's greatest geniuses:

The search for morality should be the of the upmost importance in our lives, even if it makes us feel uncomfortable.

One day, it would be nice to break from the chains of comfort and experience new feelings...
but we all have fears.

Going a bit further....I begin to ask myself, "What would I do if I had no fear????"

Wednesday, February 22, 2006

I am Blessed

I am so blessed with so much.

My family and friends are the greatest blessings that I have.

Hamdulilah :)

Monday, February 20, 2006

The below post was a response for an MCAT question...I thought what better way to express my views and drilling on these difficult questions than on my blog..

Questions/Comments/Concerns would be appreciated :)

Sunday, February 19, 2006

In a free and open society, censorship of the press can never be justified

In order for a society to claim to be open and free, this statement suggests that the press must have unlimited freedom to disseminate information or opinions to the public.

Censorship comes in forms ranging from purposeful exclusion of information to imprisonment of those who choose to voice their concerns or opinions that contradict common ideology.

A free society should allow its press to express ideas, concerns, or information to the public. A country that silences its citizens' right to speak freely is not a free society because it strips away the fundamental right to free speech. Take, for example, Venezuela where the press has been under constant scrutiny by President Hugo Chavez. Anyone who voices criticism of the government can be sentenced to imprisonment for up to 20 months.

On the other hand, there are times when a free society should limit the press when national security is at risk. Under this umbrella, laws should be enforced to prevent disclosure of undercover CIA operatives. The exposure of these workers will not only put them in harms way, but will also botch U.S. efforts to protect its citizens.

The deciding factor that justifies press censorship is whether or not national security is at risk.

Friday, February 17, 2006

Is it just me, or am I the only one to find this HILARIOUS

Dick Cheney, our Vice President..shoots a man...a 78 year old man....in the face

The last time that has happened in history was when Vice President Aaran Burr shot Alexander Hamilton in a duel.

The only difference is that back then, it was for reasons of honor, integrity, and political prowress...but now it is because Cheney was duck hunting...now that, is funny!

(idea from the Daily Show)

He's Just Not that Into You

Ok, so throughout this book, the saying in the title is said over and over and over

HE'S JUST NOT THAT INTO YOUUUUUUUUUUU


ah hah! Quite refreshing....like cherry limonade

The Deception of the Outside Cover

Yesterday, I received news that an old classmate of mine committed suicide. He had called my cousin a week before, asking her why she had not visited him at his work. Then a week later, he shot himself in the head with a gun.

He was a really handsome guy, an all-American blue eyed, blond hair social type...the type you would think would not have ended his life so early.

Life can be trying to say the least..I have had my share of rough days where all I want to do is crawl in a little hole and wait until everything blows over...

If only he hung in there he would have realized that what doesn't kill you really makes you stronger.

May God show mercy on him and all of us.

Monday, February 13, 2006

After all these years..

After years of attempting to have nice handwriting, today i haved decided to just let go!

Sunday, February 12, 2006

One more thing...

Just to clarify....

Scene: university biostatistics class
Time: 9am
Who: me, a friend sitting in the front row seats

out of nowhere:

Guy A: "Would you like old copies of Zoology tests?"

Me: "Uhhh...I am not taking Zoology."

Friend next to me: "Zeina, say yes, say yes, I want those tests.."

Point: Why does guy I don't know want to help me out?

Question of the Week: Is man inheritantly good?

One day I will address this question.

Saturday, February 11, 2006

Bluttering

If you were to fail, wouldn't it be better than always wondering, "What if?"

So it's 1am on a Saturday night...I just got home from an unexpected Valentine's party where I tried, for the first time, strawberry chocolate fondue..let's just say it was lovely and keep it at that..

Excuse me, yes I am a little scatter brained....why do I have to conform to conciseness all the time?

I would rather be criticized than complimented....tonight, I felt irritated by some compliment...sincere or not, I wonder what his/her motive is...lately, it just feels like so many people are trying to flatter me...OK, i know what you're thinking, but if only you knew...it's just, well, mundane..

Beauty. There are some girls who are so sweet and nice on the inside, but guess what? THEY AIN'T GETTIN' ANY...you know why? Because they don't fit the image of beauty....

That's another thing, if I was trapped in a big girl's body...would I still have guys complimenting me, holding doors open, smiling, offering me school books, free tutoring, free coffee, lessons, ...yadda yadda yadda...??

drumroll please: NOPE

Because we, yes you looking at the computer screen, and me, and anyone you know are all victims/prepetrators of enjoying to look at something/one beautiful..

that's not a crime

I just wonder if the nice girl's I met will also have their chance at love

Is the physical that important? No. Because I have come across some beautiful people in my day, and guess what? After spending one hour with them, I would rather take a stroll on hot coal...good night

Wednesday, February 08, 2006

The Irony of Love

But you made of me
A dream thing
That you pleased yourself
By worshipping

You looked at my face
And never knew
What in my heart
I asked of you

And so I said,
"It is only a game
To give to a dream
A face and a name

While the woman I am
And the man you are
Are as far apart
As star and star."

By: Louise Driscoll

The Irony of Love

Gotta be More than This

Fill my coffee cup and head out the door.

I am gonna take my chances for what I am looking for...

I have got some things to do before I die..



Well, I intended to write something insightful but instead, I am sitting eating my raspberry dressing salad with the Grammy's on.

Then this song came up and it fit right into what I wanted to say.

Monday, February 06, 2006

Please, just shoot me now

I can't take it anymore! That's it. Ce n'est pas possible. Khalas. Ich habe kopf schmerzven. Arrete! Stoppppppp....


One more day of learning Spanish with the fools will just kill me.

Sunday, February 05, 2006

Sonnet 27

Weary with toil, I haste me to my bed.
The dear repose for limbs with travel tired;
But then begins a journey in my head,
To work my mind, when body's work's expired;
For then my thoughts from far where I abide,
Intend a zealous pilgrimage to thee,
And keep my drooping eyelids open wide,
Looking on darkness which the blind do see:
Save that my soul's imaginary sight
Presents thy shadow to my sightless view,
Which, like a jewel hung in ghastly night,
Makes black night beauteous, and her old face new.
Lo, thus, by day my limbs, by night my mind,
For thee and myself no quiet find.

-Shakespeare

Time Waits for Noone

This is absolutely ridiculous, time is racing by, taking no heed to anyone but itself.

I had another interesting day at the clinic. One of my patients was on drugs and I am almost certain that his urine sample was diluted with water.

My new research project is actually interesting. Although it is not benchwork, which is what I enjoy most, it involve verifying a new program that searches and identifies genes in our genome...this will be a handy tool to use when looking at unmined genomes such as the dog genome, which has recently been updated.

Anywho, MCAT is approaching soon, and all I can say is that it is going to be an uneventful semester indeed.

Friday, February 03, 2006

Teta

My grandmother is in the hospital. She has been at bedrest for fourteen years and last night, I found out that she has a severe infection. She has a bedsore that is about 3x3 inches wide and 2 inches deep. The nurse that visits her knew about this for 4 damn weeks....and I wonder if Teta was given proper treatment.

Everytime I look into her murky eyes, I feel deep sorrow and helplessness. I knew things could have been better for her.

I do not know my grandma, nor my grandpa....on either parents' side....how pathetic