Our Need To Touch

I never understood religions that view sex as an act of sin. Physical contact is necessary to maintain sanity and physical health. The Shakers give a good example of the impact that complete chastity has on individuals. Shakers were prohibited to have sexual intercourse amongst each other and so had to express their needs in the form of ecstatic dancing and energetic ceremonies. Their deep devoutness caused them to shake uncontrollably, hence their name.

This is not a testimony that I agree with premarital sex. An act of love must be shared between two people who love each other so much that they formally have announced it to the world. Also, sex after marriage provides protection for both individuals. I have seen my friends who engage in acts before marriage have had a devastating impact when\the other partner decides to leave or cheat. Marriage is a commited step, besides making love is not making love unless it is with a person who you truely love.

Venetian Glass

As one who sails upon a wide, broken sea
Far out of land, his mind intent up on the sailing of his little boat.
On tightening ropes and shaping fair his course,

Hears suddenly, across the endless sea.
The rhythm striking of some towered clock.
And wakes from thoughtless idleness to time;
Time; the slow pulse which beats eternity!

So through the vacancy of busy life.
At intervals you cross my path and bring
The deep solemnity of passing years.
For you I have shed bitter tears, for you
I have relinquished that for which my heart cried
In selfish longing.

And to-night, having just left you, I can say"

"Tis well, Thank God I have known a soul so true,
so nobly just, so worthy to be loved."

-Amy Lowell

Typing this out helps sooth the pain.

everything will all fall into place, you just don't know it yet

Zeina is HAPPY

so, guess what? i thought i couldn't do it and i did! i did! i did! hallelujah!!!!!!!!

here it is, my defined ends:


TATTAGGTCAGTCAATAAGTTTTGTCGTTTTTTCTCAATTTTGATTTTTT CTTAGATATT
TTTTTGTGGTTATATAGAAGACTGTTAGTAATGACAAGCCCAACAATATCAGCCATATCG
GACTACTCCCAGATATTTTAAATCTCAGAACTGTGATGACGAAAAAAAAATTTTTTTTTC
GATTTTTTTTATTTTTTGGCGAAATGAAAAACTTTATATGCCCTGATGTATTAGACAGTT
AGTTGAATAAAAATCTGCAGTTAAAGCCCCATGCATAGCTTTTTGGTGGCGCTACACTCA
TTAAAATGACCAAAAATGCTTGCAAAAATGATTTTTTAAACTTTGAAGGACGCTAACTTC
CGCAACGTGCAAGATACAAAAAAGTAATCAATTACAACATTAATAAGCACATCAAGAGCT
ACATTTTATCAGTATACTACTTGTTTCTATCTTCACCCGCTGCTAAGTTACAGTCAGTTG
AAACAAGCCAAGTCCAAGTTTCAATAAACACCCTTTTTCCAGATTTTCGCCGGTAACTCC
AAAACCAGTTGTTTTCCGAAATTTTTGTCAACAGATTAAATAATCACTTTTTAATTTTAC
ACATTTTCGTAGTTGAAACTTTTGTCATATCTTAAGTGTTGGAAAAGATATCAGACAATT
AAGCGAACTCGTCCAAATTTGTAAAAAATTTCAAAAATCATCGTGAAAAAATTTCGAAAA
AAAAATTTTCAGAGAAAAAGGCCTAAACATTTTTGAAAATGAATAAGTAACTTTTAACTA
AAACTTTGCATATACTTTCATTGGTCAGCTTTACTTTTGTGGAGAGAAAAACAGAACTTT
GGAGGATTTTTCCATTTTTAAAAAACTACGCAAATTTTTTTCTTTGATGATTAATATTTT
TGCAAAAACCTTAGATATAACAAAAGTTTCAACTACAAAAATGTGTAAAATTAAAAAGTG
ATTATTTCATCTGTTGACAAAAATTTCGGCAAACAACTGGTTTTGGAGTTACAGGCGAAA
ATCTGGAAAAAATGTGTATATTAAAATTTAAAATTTGCTTAATTCAAATAAATTTTACTA
AATATTGAGTAAATATAAAAAAAAAAAGAAAATTTAAAAAATTTATAATTAATGTGCTTA
TTAATGTTGTAATTTATTACTTTTTTGTATCTTGCACATTGCGGAAGTTAGCGTCCTTCA
AAGTTTAAAAAATCATTTTTGCAAGCATTTTTGACAACTTAAACGAATATAGCGCCACCA
AAAAGCCATGCATGAAGCTTTAACTGCAGATTTTTATTCAACTAACTGTCTAATACATCA
GGGCATATAAACTTTTTCATTTCGCCAAAAAATAAAAAAAAACGAAAAAAAAAATTTTTT
TTCGTCATCACAGTTCTGACATTTAAAATATCT4GGAAGTAGTCCGATATGGCTGATATTG
TTGGGCTTGTCATTACTAACAGTCTTCTATATAACCACAAAAAAATATCTAAG AAAAAAT
CAAAACTGAGAAAAAACGACAAAACTTATTGACTGACCTAATA

Nothing in this world that's worth having comes easy.

World's Perfection

I was peeling a tangerine today and was wondering how this item came to be. One can think of it as a magic act of God which deserves merit because something so perfect cannot be an accident. The other side is thinking about the DNA mechanism of the plant that made this fruit. The way the fruit is partitioned off into slices, the thin layer of skin protecting the fruit, and the ridges that define its overall structure..

then I thought, I am really eating an ovary of a plant...going even further..smelling a flower is really just smelling a plant's genitals, i just had to say it *blush*

Overachievers Inc.

It's spring break in A-town...spent the day at the library..it's funny, the only people there were foreign students...LOOSEN UP PEOPLE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Random Rambling

I was sitting at a coffee shop and saw these girls all dolled up with their pointy heels, curly hair, and stylish handbags...to me, they looked a bit gaudy....

it is nice to look stylish, and I don't mind looking presentable to people, you know, clean and put together,...but it is when people go above and beyond with material objects such as cars, diamonds, and designer clothing that I start to cringe and think to myself of a quote from the Holy Quran:

The material things which ye are given are the conveniences of life and the glitter thereof, but that which is with God is far better and more enduring. Will ye not then be wise??

Something occured to me today, If I base my identity on mere objects, what will happen if I lose them...it is better to base yourself on intangible things.

I am not a religious person, and am just a mere student who has so much learning to do.

Have you looked up lately?

After the planetarium opening at the university, I have a newfound fascination with the stars and planets that loom above our heads.

It is the most amazing sight...a black sky with specks of diamonds thrown up everywhere...in Texas, I can see Mars so clearly...it is the "star" that looks red next to the moon.

When I feel like being inspired, I walk outside and look up.

It makes you feel insignificant yet significant, if that makes any sense.

Have you looked up lately?

After the planetarium opening at the university, I have a newfound fascination with the stars and planets that loom above our heads.

It is the most amazing sight...a black sky with specks of diamonds thrown up everywhere...in Texas, I can see Mars so clearly...it is the "star" that looks red next to the moon.

When I feel like being inspired, I walk outside and look up.

It makes you feel insignificant yet significant, if that makes any sense.

Lady Fate

Lady fate does not want me to do my research work today....I am locked out of my lab..and when I try to hop on the system from home, I learn that I don't have Microsoft office on my new laptop...

*sigh*

Je ne peux pas dormir...

So I am sitting here, waiting to sleep...but I can't..so, here I am.

There is this woman I see occasionally...an African woman who wears colorful headscarfs...today I learned that she used to be a fighter pilot for a country....my motif this year seems like a recurring theme of appearances vs. reality..because by looking at this woman, you would think she was a meager housewife, yet her life was and probably still is different than I had imagined it...

I was talked into going into the clinic tomorrow, we have 80 patients to see....that's craziness...but someone's got to do it..I think I'll wear my Nike's