Bedeh Beirut

I wish I could click my heels and be in my country.

Delete

Hey Zeina!

This is X. I am calling you because I desperately need you...remember? I only call you whenever you are of use.

Call me back!

Saterday is spelt Saturday

Sorry for any inconveniences this may have caused :)

Ain't No Sunshine When She's Gone

When she frowns, a cloud is cast upon our skies.

Saterday Recollections

There comes a point in a woman's life where the empty overtures of men, the abundant flowers, and sunshine of the world are equated with horseshit.

One is quick to state, "What an insolent and unworthy girl! She has the world at her feet and she still asks for more."

What is at your feet? Ultimate happiness for you may be a thing I dread.

My happiness will no longer be dependent on others.

If I depend on another person's wanton mood then how will I live my life?

My whole life, I sought the approval of family, friends, and the community.

There is a realization that I am living a life like a marionette and my master is the worries of "what will people think?".

Snip the strings that tie you before it is too late!

Are you stalking me?

Texas summer heat is here and the swealtering sun showed no remorse as I ran my errands on campus. The university landscape has improved tremendously since my freshman year. As I was walking to a review session, a violist in the music balcony was serenading me with her homework and I relish the two minutes before I had to imprison myself in another lecture. I passed by a good friend, who happened to run into me twice already...his reaction is: Are u stalking me? Because that would be great. I answer, "Today must be your lucky day!"

I am unsure if this is a Texan reaction (when you see someone repeatedly throughout the day) or if it is common in other cultures....but it is used often on our campus

This brings me to another afternoon coffee break with a good friend of mine, let's call her M. I am going to write more about M in the near future..but for now, M and I have been friends for years and she has showed me a view of this world that I would never have seen. I admire and consequently envy her. This envy is not the type of ill will that most people associate with envy but it is the healthy type that encourages you to work to have qualities like that person.

Today, she told me something that I would never have known about her. She, too, saw qualities in me that she also wish she had.

I never thought that she felt the same way about me. In ways, I wanted to be like her and she wanted to be like me. This type of yearning may be perceived as a type of negative emulation where we all try to have a homogenous character. I disagree. I see it as a natural yearning to exhibit qualties that we sense we lack. We all strive to be wanted and liked, so we want to exhibit qualities like intelligence, humour, and beauty to make us appealing to others.

My dad always tells me to surround myself with people whom I can learn from. These friends have shaped me into the person I am today.

When summer comes, I am going to attribute posts to those who have shaped me and also give an interesting biography of their lives...

Only In America

Guess what folks?

Today, I got paid $120 cash for giving my opinion. I swear. I am on a list and meet the criteria. I was fed, watered, paid, and asked to criticize and judge...I'd like to see this happen in Lebanon.

Only in America

Patience My Friend

You will have the world at your feet if you learn to be patient.

'But I am Lebanese, isn't there a hookup?'

Huh.

My parents were right all along.

Rude Awakening

Every word that comes out of your mouth must be censored, for you never know who you will piss off.

-ZA

Our Need To Touch

I never understood religions that view sex as an act of sin. Physical contact is necessary to maintain sanity and physical health. The Shakers give a good example of the impact that complete chastity has on individuals. Shakers were prohibited to have sexual intercourse amongst each other and so had to express their needs in the form of ecstatic dancing and energetic ceremonies. Their deep devoutness caused them to shake uncontrollably, hence their name.

This is not a testimony that I agree with premarital sex. An act of love must be shared between two people who love each other so much that they formally have announced it to the world. Also, sex after marriage provides protection for both individuals. I have seen my friends who engage in acts before marriage have had a devastating impact when\the other partner decides to leave or cheat. Marriage is a commited step, besides making love is not making love unless it is with a person who you truely love.

Venetian Glass

As one who sails upon a wide, broken sea
Far out of land, his mind intent up on the sailing of his little boat.
On tightening ropes and shaping fair his course,

Hears suddenly, across the endless sea.
The rhythm striking of some towered clock.
And wakes from thoughtless idleness to time;
Time; the slow pulse which beats eternity!

So through the vacancy of busy life.
At intervals you cross my path and bring
The deep solemnity of passing years.
For you I have shed bitter tears, for you
I have relinquished that for which my heart cried
In selfish longing.

And to-night, having just left you, I can say"

"Tis well, Thank God I have known a soul so true,
so nobly just, so worthy to be loved."

-Amy Lowell

Typing this out helps sooth the pain.

everything will all fall into place, you just don't know it yet

Zeina is HAPPY

so, guess what? i thought i couldn't do it and i did! i did! i did! hallelujah!!!!!!!!

here it is, my defined ends:


TATTAGGTCAGTCAATAAGTTTTGTCGTTTTTTCTCAATTTTGATTTTTT CTTAGATATT
TTTTTGTGGTTATATAGAAGACTGTTAGTAATGACAAGCCCAACAATATCAGCCATATCG
GACTACTCCCAGATATTTTAAATCTCAGAACTGTGATGACGAAAAAAAAATTTTTTTTTC
GATTTTTTTTATTTTTTGGCGAAATGAAAAACTTTATATGCCCTGATGTATTAGACAGTT
AGTTGAATAAAAATCTGCAGTTAAAGCCCCATGCATAGCTTTTTGGTGGCGCTACACTCA
TTAAAATGACCAAAAATGCTTGCAAAAATGATTTTTTAAACTTTGAAGGACGCTAACTTC
CGCAACGTGCAAGATACAAAAAAGTAATCAATTACAACATTAATAAGCACATCAAGAGCT
ACATTTTATCAGTATACTACTTGTTTCTATCTTCACCCGCTGCTAAGTTACAGTCAGTTG
AAACAAGCCAAGTCCAAGTTTCAATAAACACCCTTTTTCCAGATTTTCGCCGGTAACTCC
AAAACCAGTTGTTTTCCGAAATTTTTGTCAACAGATTAAATAATCACTTTTTAATTTTAC
ACATTTTCGTAGTTGAAACTTTTGTCATATCTTAAGTGTTGGAAAAGATATCAGACAATT
AAGCGAACTCGTCCAAATTTGTAAAAAATTTCAAAAATCATCGTGAAAAAATTTCGAAAA
AAAAATTTTCAGAGAAAAAGGCCTAAACATTTTTGAAAATGAATAAGTAACTTTTAACTA
AAACTTTGCATATACTTTCATTGGTCAGCTTTACTTTTGTGGAGAGAAAAACAGAACTTT
GGAGGATTTTTCCATTTTTAAAAAACTACGCAAATTTTTTTCTTTGATGATTAATATTTT
TGCAAAAACCTTAGATATAACAAAAGTTTCAACTACAAAAATGTGTAAAATTAAAAAGTG
ATTATTTCATCTGTTGACAAAAATTTCGGCAAACAACTGGTTTTGGAGTTACAGGCGAAA
ATCTGGAAAAAATGTGTATATTAAAATTTAAAATTTGCTTAATTCAAATAAATTTTACTA
AATATTGAGTAAATATAAAAAAAAAAAGAAAATTTAAAAAATTTATAATTAATGTGCTTA
TTAATGTTGTAATTTATTACTTTTTTGTATCTTGCACATTGCGGAAGTTAGCGTCCTTCA
AAGTTTAAAAAATCATTTTTGCAAGCATTTTTGACAACTTAAACGAATATAGCGCCACCA
AAAAGCCATGCATGAAGCTTTAACTGCAGATTTTTATTCAACTAACTGTCTAATACATCA
GGGCATATAAACTTTTTCATTTCGCCAAAAAATAAAAAAAAACGAAAAAAAAAATTTTTT
TTCGTCATCACAGTTCTGACATTTAAAATATCT4GGAAGTAGTCCGATATGGCTGATATTG
TTGGGCTTGTCATTACTAACAGTCTTCTATATAACCACAAAAAAATATCTAAG AAAAAAT
CAAAACTGAGAAAAAACGACAAAACTTATTGACTGACCTAATA

Nothing in this world that's worth having comes easy.

World's Perfection

I was peeling a tangerine today and was wondering how this item came to be. One can think of it as a magic act of God which deserves merit because something so perfect cannot be an accident. The other side is thinking about the DNA mechanism of the plant that made this fruit. The way the fruit is partitioned off into slices, the thin layer of skin protecting the fruit, and the ridges that define its overall structure..

then I thought, I am really eating an ovary of a plant...going even further..smelling a flower is really just smelling a plant's genitals, i just had to say it *blush*

Overachievers Inc.

It's spring break in A-town...spent the day at the library..it's funny, the only people there were foreign students...LOOSEN UP PEOPLE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Random Rambling

I was sitting at a coffee shop and saw these girls all dolled up with their pointy heels, curly hair, and stylish handbags...to me, they looked a bit gaudy....

it is nice to look stylish, and I don't mind looking presentable to people, you know, clean and put together,...but it is when people go above and beyond with material objects such as cars, diamonds, and designer clothing that I start to cringe and think to myself of a quote from the Holy Quran:

The material things which ye are given are the conveniences of life and the glitter thereof, but that which is with God is far better and more enduring. Will ye not then be wise??

Something occured to me today, If I base my identity on mere objects, what will happen if I lose them...it is better to base yourself on intangible things.

I am not a religious person, and am just a mere student who has so much learning to do.

Have you looked up lately?

After the planetarium opening at the university, I have a newfound fascination with the stars and planets that loom above our heads.

It is the most amazing sight...a black sky with specks of diamonds thrown up everywhere...in Texas, I can see Mars so clearly...it is the "star" that looks red next to the moon.

When I feel like being inspired, I walk outside and look up.

It makes you feel insignificant yet significant, if that makes any sense.

Have you looked up lately?

After the planetarium opening at the university, I have a newfound fascination with the stars and planets that loom above our heads.

It is the most amazing sight...a black sky with specks of diamonds thrown up everywhere...in Texas, I can see Mars so clearly...it is the "star" that looks red next to the moon.

When I feel like being inspired, I walk outside and look up.

It makes you feel insignificant yet significant, if that makes any sense.